View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6718_low_12 (Length: 249)
Name: NF6718_low_12
Description: NF6718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6718_low_12 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 4 - 249
Target Start/End: Complemental strand, 249462 - 249221
Alignment:
| Q |
4 |
tgcttgattccaatattccacatggatccaattggtttcttccttcttctgacatctctgctgttcagttatccatttgttctcattgctcaatctccca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249462 |
tgcttgattccaatattccacatggatccaattggtttcttccttcttctgacatctctgctgttcagttatccatttgttctcattgctcaatctccca |
249363 |
T |
|
| Q |
104 |
caaccactatcagtgttgagggaattgtttattgtgatgcctgctcaaccggcactttctctaaacacagttatctcttgccaggtatgtatgcatgtat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
249362 |
caaccactatcagtgttgagggaattgtttattgtgatgcctgctcaaccggcactttctctaaacacagttatctcttgccaggtatgt----atgtat |
249267 |
T |
|
| Q |
204 |
gtaccaagtaccttgttctttctcatgcaatatacacatggttatt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249266 |
gtaccaagtaccttgttctttctcatgcaatatacacatggttatt |
249221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University