View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6718_low_14 (Length: 217)
Name: NF6718_low_14
Description: NF6718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6718_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 6271544 - 6271723
Alignment:
| Q |
18 |
catattccccatttttaatgcaacttataaagttgaattgttggacaaagatgatgcactgtctttgttctgtcaccacgctttcggacagaaatcaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6271544 |
catattccccatttttaatgcaacttataaagttgaattgttggacaaagatgatgcactgtctttgttctgtcaccacgctttcggacagaaatcaatt |
6271643 |
T |
|
| Q |
118 |
cctttcgcagctaatcagaatttagtcaaacaggtaatggtttcatctttgaagttgtgagttttgtcgatgctcattga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6271644 |
cctttcgcagctaatcagaatttagtcaaacaggtaatggtttcatctttgaagttgtgagttttgtcgatgctcattga |
6271723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 36 - 157
Target Start/End: Original strand, 6262462 - 6262583
Alignment:
| Q |
36 |
tgcaacttataaagttgaattgttggacaaagatgatgcactgtctttgttctgtcaccacgctttcggacagaaatcaattcctttcgcagctaatcag |
135 |
Q |
| |
|
|||||||||||| ||||||||| | |||| ||||| ||||| || ||||||||||| ||||| |||||||||||||| ||||| |||||||| || |
|
|
| T |
6262462 |
tgcaacttataaggttgaattgctcagtgaagaggatgctctgtcattattctgtcaccatgcttttggacagaaatcaatccctttaacagctaatgag |
6262561 |
T |
|
| Q |
136 |
aatttagtcaaacaggtaatgg |
157 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
6262562 |
aatttggtcaaacaggtaatgg |
6262583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University