View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6719_low_16 (Length: 236)
Name: NF6719_low_16
Description: NF6719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6719_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 2 - 198
Target Start/End: Original strand, 37443897 - 37444087
Alignment:
| Q |
2 |
tgataacgaagaaagactaattttacctacgtccccatagcggttgcggttcaaattcgtattatgtgatgtatgattttaaacttaggatttacaaaag |
101 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37443897 |
tgataacgaagaaagaccaattttacctacgtccccatagcggttgcggttcaaattcgtattatgt-----atgattttaaacttaggatttacaaaag |
37443991 |
T |
 |
| Q |
102 |
tacctactgaccgccttcaccccaacaccccagcccgtcaacctaacaaacgtttgggtctagcctaaagggcaggtctctctcactctacttgatg |
198 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37443992 |
tacctactgaccgccttcaccc-agcaccccagcccgtcaacctaacaaacgtttgggtctagcctaaagggcaggtctctctcgctctacttgatg |
37444087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University