View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6722_high_18 (Length: 294)
Name: NF6722_high_18
Description: NF6722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6722_high_18 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 44 - 294
Target Start/End: Original strand, 41603041 - 41603291
Alignment:
| Q |
44 |
gttcacttgctagaattcaaagaagaaagttcaatttgttttttgaaaaatgtgtcatccacataccgaagatgagatacgacttctttcgaattctcag |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41603041 |
gttcacttgctagaattcaaagaagaaagttcaatttgttttttgaaaaatgtgtcatccacataccgaagatgagatacgacttctttcgaattctcag |
41603140 |
T |
 |
| Q |
144 |
tctggatccccttaaatagcctagtcctactgcctttttcatcaacgctcccataccttccacaaccaatacaaatagatatggggctaaaagatctccc |
243 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||| ||| |
|
|
| T |
41603141 |
tctggatccccttaaatagcctagtccaactgcctttttcatcaacgctcccataccttccacaatcaatagaaatagatacggggctaaaagatccccc |
41603240 |
T |
 |
| Q |
244 |
tgtttcaaccccttactaatttgcacttgttctgttggacacccatttacc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41603241 |
tgtttcaaccccttactaatttgcacttgttccgttggacacccatttacc |
41603291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 41603002 - 41603031
Alignment:
| Q |
1 |
taaagtgaactcaatagaaagcttcttgcc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41603002 |
taaagtgaactcaatagaaagcttcttgcc |
41603031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University