View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6722_low_18 (Length: 331)
Name: NF6722_low_18
Description: NF6722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6722_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 23 - 313
Target Start/End: Complemental strand, 35410318 - 35410029
Alignment:
| Q |
23 |
gagatactgtatgcaaattacgtgtgctgcctataaagattggtggcgatttgacatggaaggtcttcctgccgatcttaaaagaaggtaaagaagatag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35410318 |
gagatactgtatgcaaattacgtgtgctgcctataaagattggtggcggtttgacatggaaggtcttcctgccgatcttaaaagaaggtaaagaagatag |
35410219 |
T |
 |
| Q |
123 |
tttccttcatcaaagttttctgtgcaatgagcttggttttacttgttctttcatttgttctttcactaagtgaagaagataagatctaactatttattct |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35410218 |
tttccttcatcaaagttttctgctcaatgagcttggttttacttgttctttcatttgttctttcactaagtgaagaagataagatctaactatttattct |
35410119 |
T |
 |
| Q |
223 |
ttcnnnnnnnncagaggtttggcggttccagatgccactcagccacatggcattagactacttattgaagattatccttatgcggctgatg |
313 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35410118 |
ttc-tttttttcagaggtttggcggttccagatgccactcggccacatggcattagactacttattgaagattatccttatgcggctgatg |
35410029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University