View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6722_low_22 (Length: 310)
Name: NF6722_low_22
Description: NF6722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6722_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 127 - 301
Target Start/End: Complemental strand, 10385711 - 10385537
Alignment:
| Q |
127 |
tatgcgccgatctctcaccatagacagaaccttaaactcatctatcccttttgaaacatcaaaagaaagcacaacattctacaagtcaaagaacagttct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10385711 |
tatgcgccgatctctcaccatagacagaaccttaaactcatctatcccttttgaaacatcaaaagaaagcacaacattctacaagtcaaagaacagttct |
10385612 |
T |
|
| Q |
227 |
gcaaccccttgcaagatagctctgatgataaaattctttctagatctagcaagacaacaccacaattatgatgtc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10385611 |
gcaaccccttgcaagatagctctgatgataaaattctttctagatctagcaagacaacaccatgattatgatgtc |
10385537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University