View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6722_low_29 (Length: 265)
Name: NF6722_low_29
Description: NF6722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6722_low_29 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 35 - 265
Target Start/End: Complemental strand, 4708361 - 4708132
Alignment:
| Q |
35 |
atgaaaaccttaatggtatagaatccatgaccannnnnnnnaaagaagaatccatgataattttgcagatagtcgttgacgccctaattgatcctaaagt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
4708361 |
atgaaaaccttaatggtatagaatccatgatcattttttttaaagaagaatccatgatcattttgcagatagtcgttgacaccctacttgatcctaaagt |
4708262 |
T |
 |
| Q |
135 |
ggttataagatatgaccccaagtcactggttagaggtcttgctgacctaatagagagatacacgaaggcgcaggttactggctgaaacatacttttgaag |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
4708261 |
ggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatacacgaagtcgcaagttactggctgaatcatacttttgaag |
4708162 |
T |
 |
| Q |
235 |
ttttgtcatcacaatatacatagtatgaaat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4708161 |
-tttgtcatcacaatatacatagtatgaaat |
4708132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 96 - 196
Target Start/End: Complemental strand, 4745984 - 4745884
Alignment:
| Q |
96 |
tttgcagatagtcgttgacgccctaattgatcctaaagtggttataagatatgaccccaagtcactggttagaggtcttgctgacctaatagagagatac |
195 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||||| ||||| |||||| || ||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
4745984 |
tttgcagatagttgttgactccctacttgatcctaaagtgggtataatatatgatccaaagtcactgattagagctcttgctgacctaatagagagatac |
4745885 |
T |
 |
| Q |
196 |
a |
196 |
Q |
| |
|
| |
|
|
| T |
4745884 |
a |
4745884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University