View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6726_high_6 (Length: 357)
Name: NF6726_high_6
Description: NF6726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6726_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 2 - 353
Target Start/End: Original strand, 32179692 - 32180043
Alignment:
| Q |
2 |
ccaagagatcgttcactgttacgtgttcaagaatttcagcaattcgcttctctagttcacgcttgcacgcgctagaggcgcgtaggtagatagcacaccg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
32179692 |
ccaagagatcgttcactgttacgtgttccagaatttcagctattcgcttctcgagttcgcgcttgcacgcgcttgaggcgcgtaggtagatagcacaacg |
32179791 |
T |
|
| Q |
102 |
gagaaggcagcagaggaagttgatcggaaaagcagctttctccgacggaaagagagggacgatggattgtagaatctcacgttgttcggattttgtttct |
201 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32179792 |
gagaagacagcagaggaagttgatcggaaaagcagctttctccgacggaaagagagggacgatggattgtagaatctcacgttgttcggattttgtttct |
32179891 |
T |
|
| Q |
202 |
gaatcggaatctgttgaatcagatgaccggaattttcctccaccaccacttccaccaccggtttgatcacgtacaagctcccggagcgtgcgttctgtgt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32179892 |
gaatcggaatctgttgaatcagatgaccggaattttcctccaccaccacttccaccaccggtttgatcacgtacaagctcccggagcgtgcgttctgtgt |
32179991 |
T |
|
| Q |
302 |
atgcaatcaacgctccggcgagagttaggtatttcgcgccacgttgtttcat |
353 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32179992 |
atgcaatcaacgccccggcgagagttaggtatttcgcgccacgttgtttcat |
32180043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 76 - 156
Target Start/End: Original strand, 28250185 - 28250265
Alignment:
| Q |
76 |
gaggcgcgtaggtagatagcacaccggagaaggcagcagaggaagttgatcggaaaagcagctttctccgacggaaagaga |
156 |
Q |
| |
|
|||||||| |||| ||| || || ||||| |||||||| ||||||||||| |||||||| ||||||||||| || |||||| |
|
|
| T |
28250185 |
gaggcgcggaggtggatggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctccgaagggaagaga |
28250265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University