View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6726_low_1 (Length: 765)
Name: NF6726_low_1
Description: NF6726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6726_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 4e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 624 - 711
Target Start/End: Original strand, 38964477 - 38964564
Alignment:
| Q |
624 |
atttgagcaggacagtgctcatataaaaaccaaggaaaacccccctcacaggccatatttgccaatacgtctgcacaagcatttgctt |
711 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38964477 |
atttgagcaagacagtgctcatataaaaaccaaggaaaacccccctcacaggccatatttgccaatacgtatgcacaagcatttgctt |
38964564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 624 - 746
Target Start/End: Complemental strand, 134022 - 133898
Alignment:
| Q |
624 |
atttgagcaggacagtgctcatataaaaaccaaggaaaacccccctc---acaggccatatttgccaatacgtctgcacaagcatttgcttctatttagg |
720 |
Q |
| |
|
|||||||||||| | ||||| ||||||| ||||||||| |||||| | ||| |||||||||| |||| | ||||||||||||||||||||| | |||| |
|
|
| T |
134022 |
atttgagcaggataatgctcgtataaaa-ccaaggaaaccccccccccctacaagccatatttgtcaatgcatctgcacaagcatttgcttctctctagg |
133924 |
T |
 |
| Q |
721 |
agtgccagattcggacctcccaattc |
746 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
133923 |
agtgccgaattcggacctcccaattc |
133898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 668 - 746
Target Start/End: Original strand, 14793074 - 14793152
Alignment:
| Q |
668 |
ctcacaggccatatttgccaatacgtctgcacaagcatttgcttctatttaggagtgccagattcggacctcccaattc |
746 |
Q |
| |
|
|||||| |||||||||| ||| ||||| | ||||||||||||||| | || ||||||| |||||||||||||||||| |
|
|
| T |
14793074 |
ctcacaagccatatttgtcaacgcgtctacgcaagcatttgcttctttgtatgagtgccgaattcggacctcccaattc |
14793152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University