View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6726_low_10 (Length: 341)
Name: NF6726_low_10
Description: NF6726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6726_low_10 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 59 - 341
Target Start/End: Complemental strand, 40660450 - 40660168
Alignment:
| Q |
59 |
aaggtttatggtgcaccgcaccgcaactagttctaacatggatggagctatggtttcattgttctccagcttcttcgaccctccataatgataagtttcc |
158 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40660450 |
aaggtttatggtgtaccgcactgcaactagttctaacatggatggagctatggtttcatcgttctccagcttcttcgaccctccattatgataagtttct |
40660351 |
T |
|
| Q |
159 |
aatctagctttgacgcttgcaattgtgtgttgtttgatccccggagcatgacaattggcttatgccaatgatcaatcaaattgtgtttgatactaattgg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660350 |
aatctagctttgacgcttgcaattgtgtgttgtttgatctccggagcatgacaattggcttatgccaatgatcaatcaaattgtgtttgatactaattgg |
40660251 |
T |
|
| Q |
259 |
ttactttttggtttaataaatgggattctatagaggatactaaaatcataagattatatggaccctactccaagtacatcact |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660250 |
ttactttttggtttaataaatgggattctatggaggatactaaaatcataagattatatggaccctactccaagtacatcact |
40660168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 40
Target Start/End: Complemental strand, 40660507 - 40660469
Alignment:
| Q |
2 |
gtttggtgctgtctcagtggaaacagcaccttggcacag |
40 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40660507 |
gtttggtgctgtctaagtggaaacagcaccttggcacag |
40660469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University