View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6726_low_12 (Length: 332)
Name: NF6726_low_12
Description: NF6726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6726_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 86 - 322
Target Start/End: Original strand, 34534068 - 34534304
Alignment:
| Q |
86 |
ttgtactcttgaagatgaggtcacaatttcctcatccaaggatctatttggttctgaaattggttttgaagcttcattttctgctgatccaggcttagat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34534068 |
ttgtactcttgaagatgaggtcacaatttcctcatccaaggatctatttggttctgaaattggttttgaagcttcattttctgctgatccaggcttagat |
34534167 |
T |
|
| Q |
186 |
cctccccgattttcagagctctcataagaaacccttgaagacttccatccaagccttgaaccaggagtcacaggagcttcagatgaaggagcgtgatcag |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34534168 |
cctccccgattttcagagctctcataagaaacccttgaagacttccatccaagccttgaaccaggagtcacaggagcttcagatgaaggagcgtgatcag |
34534267 |
T |
|
| Q |
286 |
agcttaaaactgtaccggtttttggagaagctgatgt |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34534268 |
agcttaaaactgtaccggtttttggagaagctgatgt |
34534304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 3 - 90
Target Start/End: Original strand, 34533952 - 34534039
Alignment:
| Q |
3 |
atgagatggacatcaaaggaatcgtaatcaggtaactttggatgaacgtgatctgctttctgcttagatggagggtcactgtcttgta |
90 |
Q |
| |
|
|||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533952 |
atgaaatgggcagcaaaggaatcgtaatcaggtaactttggatgaacgtgatctgctttctgcttagatggagggtcactgtcttgta |
34534039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University