View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6726_low_14 (Length: 299)
Name: NF6726_low_14
Description: NF6726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6726_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 15 - 277
Target Start/End: Complemental strand, 42042841 - 42042579
Alignment:
| Q |
15 |
acctgtgtatgaagaatttttcctctgtctagctaacgcatgctttgcttcctcttagtaaacatatatatactacttgcatgaagattaagaaatagat |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042841 |
acctgtgcatgaagaatttttcctctgtctagctaacgcatgctttgcttcctcttggtaaaaatatatatactacttgcatgaagattaagaaatagat |
42042742 |
T |
 |
| Q |
115 |
gcattcattcaaagtgtcaacaagtgacgtgtgttttcacatgttaaattggtttatatacatatatatactattgaagaaagtcttaattaaacaacca |
214 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042741 |
gcgttcattcaaagtgtcaacaagtgacgtgtgttttcacatgttaaattggtttatatacatatatatactattgaagaaagtcttaattaaacaacca |
42042642 |
T |
 |
| Q |
215 |
atcatggatgagaaaatcttatttttgtgtcatttgataaggacaaatgaagttcctatgtcg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042641 |
atcatggatgagaaaatcttatttttgtgtcatttgataaggacaaatgaagttcctatgtcg |
42042579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University