View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6726_low_20 (Length: 244)
Name: NF6726_low_20
Description: NF6726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6726_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 225
Target Start/End: Complemental strand, 47215145 - 47214931
Alignment:
| Q |
11 |
ggacatcagatacataaattggattcggatccattatctttaagatgggaaagtcgctgtgacattacaattttcataggagtgtatattgtttctgaga |
110 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
47215145 |
ggacatcagacacataaattggattcggatccactacctttaagatgggaaagtcgctgtgacattacaattttcataagagtgtatattatttctgaga |
47215046 |
T |
 |
| Q |
111 |
gaaatttaagctnnnnnnngttattatttataattaaacactgttatgggaatctaattaaggtttattgataaatattcatgcaccttaacaacatacc |
210 |
Q |
| |
|
||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47215045 |
gaagttcaagctaaaaaaagttattatttataattaaacactgttatgggaatctaattaaggtttattgataaatattcatgcaccttaacaacatacc |
47214946 |
T |
 |
| Q |
211 |
atcatgtgagggtgg |
225 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47214945 |
atcatgtgagggtgg |
47214931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University