View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6726_low_26 (Length: 236)
Name: NF6726_low_26
Description: NF6726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6726_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 115 - 214
Target Start/End: Complemental strand, 45379348 - 45379249
Alignment:
| Q |
115 |
tataacttatcttgaaagtgatattttttgagacacggcaacacttctctcaattgaatgcgatatttattcgccacactaaaatgttaacacttctctc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45379348 |
tataacttatcttgaaagtgatattttttgagacacggcaacacttctctcaattgaatgcgatatttattcgccacactaaaatgttaacacttctctc |
45379249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University