View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6726_low_9 (Length: 350)
Name: NF6726_low_9
Description: NF6726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6726_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 329
Target Start/End: Complemental strand, 40660797 - 40660473
Alignment:
| Q |
1 |
aaataggaagtaat-gaaaaggcagcagccataaccaagatcaacatcttagagatataggagttatagattacgcgctagttttttactactacctccg |
99 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660797 |
aaataggaagcaatagaaaaggcagcagccataaccaagatcaacatcttagagatataggagttatagattacgcgctagttttttactactacctccg |
40660698 |
T |
|
| Q |
100 |
gtttgttatacaatagacatcatgtacatttgttatgattgcaattaagcatgaagcacatgttaatgaggccagtctgctactttttgtctacttgatt |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40660697 |
gttttttatacaatagacatcatgtacatttgttatgattgcaattaagcatgaagcacatgttaatgaggccagtctgctactttttgtccacttgatt |
40660598 |
T |
|
| Q |
200 |
gtggttgtctttgttatttgatttcgagcaagttactcaaggggaaatagaagtgcagattattctggatttagctcaatatttggtttggtttggtttg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40660597 |
gtggttgtctttgttatttgatttcgagcaagttactcaaggggaaatagaagtgcagattattctggatttagctcaatatttggtttggtt-----tg |
40660503 |
T |
|
| Q |
300 |
gtgctgtctaagtggaaacagcaccttggc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40660502 |
gtgctgtctaagtggaaacagcaccttggc |
40660473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University