View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6727_high_18 (Length: 270)
Name: NF6727_high_18
Description: NF6727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6727_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 16365322 - 16365065
Alignment:
| Q |
1 |
taagaaatgaattttctttgttattgtttaatgtgatcaaagaaatgaattgattcgagtatatgtgattttggacttattgtatttagaccatttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16365322 |
taagaaatgaattttctttgttattgtttaatctgatcaaagaaatgaattgattcgagtatatgtgattttggacttattgtatttagactatttgatt |
16365223 |
T |
 |
| Q |
101 |
aatatgttaatctagagtatgcaaactatttcctttacgtattg---tgcaccagaatgaataatgaattttgtggccaagtttgttggagttagttttt |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16365222 |
aatatgttaaactagagtatgcaaactatttcctttacgtattgtgttgcaccagaatgaataatgaattttgtggccaagtttgttggagttagtttt- |
16365124 |
T |
 |
| Q |
198 |
aatgcttttgagttcattcagtgttgagatttaatgctcttaataagtggattggttgat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16365123 |
-ctgcttttgagttcattcagtgttgagatttaatgctcttaataagtggattggttgat |
16365065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University