View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6727_high_22 (Length: 240)
Name: NF6727_high_22
Description: NF6727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6727_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 54543414 - 54543243
Alignment:
| Q |
1 |
ttggtgtaaaggaaccaggacccagctgctgtaattgttattctcttatagttaggttggccttttcttattgtatacctcagcctcatcttttgtgtga |
100 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54543414 |
ttggtgtaaagggaccaggacc-agctgctgtaattgttattctcttatagctaggttggccttttcttattgtatacctcagcctcatcttttgtgtga |
54543316 |
T |
 |
| Q |
101 |
ggtggttgctgtctgtttttgggcggctccttgaggttaacagtttccaacgcatatctctccaccctcatat |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54543315 |
ggtggttgctgtctgtttttgggcggctccttgaggttaacagtttccaatgcatatctctccaccctcatat |
54543243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 54543171 - 54543116
Alignment:
| Q |
173 |
tctggaaatgttctcacataacattgaaacattgctatcgtatcactgcttgactg |
228 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54543171 |
tctggaaatgttcacacataacattgaaacattgctatcgtatcactgcttgactg |
54543116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University