View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6727_low_23 (Length: 353)
Name: NF6727_low_23
Description: NF6727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6727_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 337
Target Start/End: Complemental strand, 7554438 - 7554102
Alignment:
| Q |
1 |
tctgcatataagccctaagattatcaacaacaacactcgacgaagaattcgtagaagatgactcaagagttcgttcaagttcagcaaggtagcccgaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554438 |
tctgcatataagccctaagattatcaacaacaacactcgacgaagaattcgtagaagatgattcaagagttcgttcaagttcagcaaggtagcccgaaaa |
7554339 |
T |
 |
| Q |
101 |
agagagggaagattgaaggtagagcgggctgggctctaatgaccatgttgagaaagcggttatgaagcccgtgggctcgaatgggtcttcttcttcgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554338 |
agagagggaagattgaaggtagagcgggctgggctctaatgaccatgttgagaaagcggttatgaagcccgtgggctcgaatgggtcttcttcttcgttg |
7554239 |
T |
 |
| Q |
201 |
gtatcggtgttggtttggttgagagtggggggagggagatctggtgtgacgaggcataggggattatcttgggcgcgcaggtggaagatgtggtggggat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554238 |
gtatcggtgttggtttggttgagagtggggggagggagatctggtgtgacgaggcataggggattatcttgggcgcgcaggtggaagatgtggtggggat |
7554139 |
T |
 |
| Q |
301 |
gggattgtcgttcttctacgacgcggccgcatgatgt |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554138 |
gggattgtcgttcttctacgacgcggccgcatgatgt |
7554102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University