View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6727_low_27 (Length: 329)

Name: NF6727_low_27
Description: NF6727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6727_low_27
NF6727_low_27
[»] chr6 (2 HSPs)
chr6 (205-318)||(8027471-8027584)
chr6 (19-122)||(8027214-8027326)


Alignment Details
Target: chr6 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 205 - 318
Target Start/End: Original strand, 8027471 - 8027584
Alignment:
205 atgtgttgtttgatgagtaaagttgaactaattatatgatacgttatgataaccttatatgaggatacatgatgatattaatgatgtgactaatttgaga 304  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8027471 atgtgtggtttgatgagtaaagtttaactaattatatgatacgttatgataaccttatatgaggatacatgatgatattaatgatgtgactaatttgaga 8027570  T
305 tacatgaatattct 318  Q
    | ||||||||||||    
8027571 tgcatgaatattct 8027584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 122
Target Start/End: Original strand, 8027214 - 8027326
Alignment:
19 atgtgaaagcttcaataaggtacgaggtgagagtgagtttaaattatgagtgtaaa---------ataaatgggaaagctgtattaaagggttgtaactc 109  Q
    |||||||||||||||||||||| | |||||||||||||||||||||| ||||||||         ||||||||||||||| |||||||||||||||||||    
8027214 atgtgaaagcttcaataaggtatggggtgagagtgagtttaaattataagtgtaaaataaatgtgataaatgggaaagctttattaaagggttgtaactc 8027313  T
110 ttgagagataatc 122  Q
    |||||||||||||    
8027314 ttgagagataatc 8027326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University