View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6727_low_41 (Length: 241)
Name: NF6727_low_41
Description: NF6727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6727_low_41 |
 |  |
|
| [»] chr4 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 108 - 241
Target Start/End: Complemental strand, 4155008 - 4154876
Alignment:
| Q |
108 |
aacattttcttataattatggatatgcatatattccagttttaaaaagaggtgatttatagtgaattttaaacnnnnnnnnnaaggaagtgaatttttaa |
207 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
4155008 |
aacattttcttataattatggacatacatatattccagttttaaaaagaggtgatttataatgaattttaaac-ttttttttaaggaagtgaatttttaa |
4154910 |
T |
 |
| Q |
208 |
cttgaaatcacccttttaaatcatttttatcctt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4154909 |
cttgaaatcacccttttaaatcatttttatcctt |
4154876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 69 - 124
Target Start/End: Complemental strand, 4155076 - 4155021
Alignment:
| Q |
69 |
gcaagtggttttcattagataacttaaaagtgacttgataacattttcttataatt |
124 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4155076 |
gcaagtggttttcatgagataacttaaaagtgacttgttaacattttcttataatt |
4155021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 4155169 - 4155131
Alignment:
| Q |
8 |
agatagcattcatcatttccatgctgcaattattgaagg |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4155169 |
agatagcattcatcatttccatgctgcaattattgaagg |
4155131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 41
Target Start/End: Complemental strand, 4160329 - 4160300
Alignment:
| Q |
12 |
agcattcatcatttccatgctgcaattatt |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4160329 |
agcattcatcatttccatgctgcaattatt |
4160300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University