View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6727_low_44 (Length: 233)
Name: NF6727_low_44
Description: NF6727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6727_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 23 - 213
Target Start/End: Original strand, 51211631 - 51211817
Alignment:
| Q |
23 |
acaaggtatgaatgcagcatcatttgatctaaccatgataacaaaattcgaagataataataactcattcttccttttttggtggatatatatgttctgc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51211631 |
acaaggtatgaatgcagcatcatttgatctaaccatgataacaaaattcgaagataataataactcattcttccttttttggtggatat----gttctgc |
51211726 |
T |
 |
| Q |
123 |
aggtaggaaaattcatacaatatgtgtcatgttttttaggaggtttagttgtggcattcatcttgggttggcttctaacccttgtccttct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51211727 |
aggtaggaaaattcatacaatatgtgtcatgttttttaggaggtttagttgtggcattcatcttgggttggcttttaacccttgtccttct |
51211817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 213
Target Start/End: Complemental strand, 49738446 - 49738355
Alignment:
| Q |
122 |
caggtaggaaaattcatacaatatgtgtcatgttttttaggaggtttagttgtggcattcatcttgggttggcttctaacccttgtccttct |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
49738446 |
caggtaggaaaattcatacagtatgtgtcatcttttttaggaggtttagttgttgcattcatcaagggttggcttctaagccttgtccttct |
49738355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University