View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6727_low_45 (Length: 223)
Name: NF6727_low_45
Description: NF6727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6727_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 42138709 - 42138509
Alignment:
| Q |
1 |
tgttgaagtttaacatggttttttaacatttcatttatctatctatgttaagcaactattactaatcaaaacatgtttttatttagagaaatggacgaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
42138709 |
tgttgaagtttaacatggttttttaacatttcatttatctatctatgttaagcgactattactaatcaaaacatgcttttatttagagaaatggatgaga |
42138610 |
T |
|
| Q |
101 |
taactacattcatcaaaggtgctatttctgacaatcaatgtctggggcgttgcctctatattcacggtgttccgggcactggcaaggtactatcttctag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42138609 |
taactacattcatcaaaggtgctatttctgacaatcaatgtctggggcgttgcctctatattcacggtgttccgggcactggcaaggtactatcttctag |
42138510 |
T |
|
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
42138509 |
a |
42138509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University