View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6727_low_49 (Length: 203)
Name: NF6727_low_49
Description: NF6727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6727_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 70 - 185
Target Start/End: Complemental strand, 46000632 - 46000517
Alignment:
| Q |
70 |
tttatttaagtatcaaccttattattagcaattgcccctaataatttctggccattatccatgtgggttaatatatccatattttttacacgcccctaat |
169 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46000632 |
tttatttaagtatcaactttattattagcaattgcccctaataatttctggccattatccatgtcggttaatatatccatattttttacacgcccctaat |
46000533 |
T |
|
| Q |
170 |
tgtgtgtgccattgtt |
185 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46000532 |
tgtgtgtgccattgtt |
46000517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 46000714 - 46000660
Alignment:
| Q |
17 |
gctggtgcaggaa---catcaatgttgtcatggatagtatggtggacctgtgaat |
68 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46000714 |
gctggtgcaggaagatcatcaatgttgtcatggatagtatggtggacctgtgaat |
46000660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University