View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6729_high_20 (Length: 255)
Name: NF6729_high_20
Description: NF6729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6729_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 59 - 216
Target Start/End: Original strand, 12274111 - 12274267
Alignment:
| Q |
59 |
ttgttgtgtttcacagagatgaatgacacactctctttcgtgttaacagaggaacatttgagagaaagaagcgatgtttggtgtaactaggactttt-gg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| || |
|
|
| T |
12274111 |
ttgttgtgtttcacagagatgaatgacacactct--ttcgtgttaacagaggaacatttgagcgaaagaagcgatggttggtgtaactaggacttttggg |
12274208 |
T |
 |
| Q |
158 |
agacttttgtcaaccgcctgcatagaatgttcaagtccttttccgtgttttctactttc |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274209 |
agactattgtcaaccgcctgcatagaatgttcaagtccttttccgtgttttctactttc |
12274267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 12274071 - 12274112
Alignment:
| Q |
1 |
cggtgtccatggctgtaacaattatttgaacgaacctgtctt |
42 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12274071 |
cggtgtccatggctataacaattatttgaacgaacctgtctt |
12274112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University