View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6729_high_21 (Length: 253)
Name: NF6729_high_21
Description: NF6729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6729_high_21 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 50 - 253
Target Start/End: Original strand, 3423590 - 3423794
Alignment:
| Q |
50 |
taatttaaataattgtttgtgaaagaattatttttatgtgtaaatgagtatttgtgaaagcaattacaaagactaatatctcatgttggatagaacttta |
149 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
3423590 |
taatttaaataattgtttgtgtaagaagtatttttgtgtgtaaatgagtatttgtgaaagcaattacaaagattaatatcttgtgt-ggatagaacttta |
3423688 |
T |
 |
| Q |
150 |
tattcggtaaaactttttatagag--tgaaaacattggagtattcttagagctagatttaatctttgacggttggttaacttaaaatgacgatagggtta |
247 |
Q |
| |
|
|| |||||||||| ||| |||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423689 |
taatcggtaaaacatttcatagagagtgaaaacaatggagtattcttagagctagattcaatctttgacggttggttaacttaaaatgacgatagggtta |
3423788 |
T |
 |
| Q |
248 |
aatatt |
253 |
Q |
| |
|
|||||| |
|
|
| T |
3423789 |
aatatt |
3423794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 3423112 - 3423169
Alignment:
| Q |
1 |
tcaaaacctaagtccttttaatgcttgaaaatgttgaactttttgtgtataatttaaa |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423112 |
tcaaaacctaagtccttttaatgcttgaaaatgttgaactttttgtgtataatttaaa |
3423169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University