View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6729_low_15 (Length: 321)
Name: NF6729_low_15
Description: NF6729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6729_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 321
Target Start/End: Complemental strand, 42935888 - 42935565
Alignment:
| Q |
1 |
caatgaagatggattggaacttgtgcctgtattcccaaaggatcaaagcaaagatgatgaagttgtgaaacaagttcggttcgaagaagaaaaagtgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935888 |
caatgaagatggattggaacttgtgcctgtattcccaaaggatcaaagcaaagatgatgaagttgtgaaacaagttcggttcgaagaagaaaaagtgatc |
42935789 |
T |
 |
| Q |
101 |
caagaggatgatgttgttacagcatcaggaactgtgatggagccaaagaccaatactactgat---gttgatcatgaaaatgttggtggtgttgttaaga |
197 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
42935788 |
caagaggatgctgttgttacagcatcaggaactgtgatggagccaaagaccaatacttctgatgtggttgatcatgaaaatgtcggtggtgttgttaaga |
42935689 |
T |
 |
| Q |
198 |
accgcgaggctacgttggcaacgttgaatgtgttgaaagagagcttggaacaagagttgggacaagttaggtttctaatgaatctaattggtggagagga |
297 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42935688 |
accgtgaagctacgttggcaacgttgaatgtgttgaaagagagcttggaacaagagttgggacaagttaagtttctaatgaatctaattggtggagagga |
42935589 |
T |
 |
| Q |
298 |
gattcatgtggctgaaagtgatga |
321 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42935588 |
gattcatgtggctgaaagtgatga |
42935565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University