View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6729_low_21 (Length: 277)
Name: NF6729_low_21
Description: NF6729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6729_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 19399103 - 19399358
Alignment:
| Q |
1 |
tccaagatatgggttattgtcaactgcacgagggatccggtaaaaaactacaggtaaactttactttgagagacttgagtgttattactcttaactgtac |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
19399103 |
tccaagatatgagttattgtcaactgcacgagggaatcggtaaaaaactgcaggtcaactttactttgagagacttgagtgttattacttttaactgcac |
19399202 |
T |
 |
| Q |
101 |
tctatgggagagactatgctatgaagtttattcatgataatgagaggaaagaatatgaaccagtaattgttatactgaagtatgccaaagttaaagaaga |
200 |
Q |
| |
|
|| ||| ||| |||||||||| |||||||||||| |||||| |||| |||||||||| ||| || |||||||| ||||||||||||||||||||||||| |
|
|
| T |
19399203 |
tccatgagag-gactatgctaggaagtttattcacgataataagagaaaagaatatggaccggtcattgttatgttgaagtatgccaaagttaaagaaga |
19399301 |
T |
 |
| Q |
201 |
atgttcgttatatttaatacgtttgcgtccatatagtcattggtcttatgtttgctt |
257 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19399302 |
atgttcgttatgtttaatacgtttgcgtccatatagtcattggacttatgtttgctt |
19399358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 20220358 - 20220290
Alignment:
| Q |
42 |
aaaaaactacaggtaaactttactttgagagacttgagtgttattactcttaactgtactctatgggag |
110 |
Q |
| |
|
|||||||| || || ||||||||||||||||||||||||| | | |||||||| || ||| |||||||| |
|
|
| T |
20220358 |
aaaaaacttcaagtcaactttactttgagagacttgagtgatgtcactcttaattgcactttatgggag |
20220290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University