View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6729_low_27 (Length: 245)
Name: NF6729_low_27
Description: NF6729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6729_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 157
Target Start/End: Original strand, 26287402 - 26287450
Alignment:
| Q |
109 |
tgtttccggtcgttagtgctggttgtggtaatgttgaatgaggagcttg |
157 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26287402 |
tgtttccggttgttagtgttggttgtggtaatgttgaatgaggagcttg |
26287450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University