View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6729_low_9 (Length: 408)
Name: NF6729_low_9
Description: NF6729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6729_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 64 - 402
Target Start/End: Complemental strand, 25698335 - 25697988
Alignment:
| Q |
64 |
atttgcatattaagtctcacggactatgaaaattaaaatgcattgatcgatcgagtagatatgcaatacaaaccatgcatcttaattaatcttgtaacnn |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||| |||||||||||||||||||||||||| | |
|
|
| T |
25698335 |
atttgcatattaagtctcacggactatgaaaattaaaatgcatagatcgatcgagtatatatacaataaaaaccatgcatcttaattaatcttgttagaa |
25698236 |
T |
 |
| Q |
164 |
nnnnncacaagaagctacaaaat---------caccaagggacaaatcgatccataagcaaaaacacggttttctctgacatagagtgtgaggcagacgt |
254 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
25698235 |
aagaacacaag---ctacaaaatatatatcatcaccaagggacaaatcgatccataagcaaaaacacagttttctctgacatagagtgtgaggcagaggt |
25698139 |
T |
 |
| Q |
255 |
gtctctacgaggaacaccaacgttgtcattgttgttttgatctattgcttgtttggattttgagaacaaaggatt---gctgataggaagaactttttct |
351 |
Q |
| |
|
||||||| | ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25698138 |
gtctctaaggggaacaccaacgttgtccttgttgttttgatctattgcttgcttggattttgagaacaaaggattgctgctgataggaagaactttttct |
25698039 |
T |
 |
| Q |
352 |
ctgagctttgaaagtttaccaacccatacttctgcaattgcacccattttt |
402 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
25698038 |
ctgagctttgaaagtttaccaacccatgcctctacaattgcacccattttt |
25697988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 185 - 361
Target Start/End: Complemental strand, 25681605 - 25681417
Alignment:
| Q |
185 |
atcaccaagggacaaatcgatccataagcaaaaacacggttttctctgacat------agagtgtgagg---cagacgtgtctctacgaggaacaccaac |
275 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||| ||||||||| ||||| |||| |||| |||||||| | ||||||||||| |
|
|
| T |
25681605 |
atcaccaaggaacaaatcgatccataagcaaacacacggttgcctctgacatagttgaagagtcagaggcaacagaggtgtctcttggtggaacaccaac |
25681506 |
T |
 |
| Q |
276 |
gttgtcattgttgttttgatctattgcttgtttggattttgagaacaaaggattgc---tgataggaagaactttttctctgagctttg |
361 |
Q |
| |
|
||| | ||||||||||||||| | | ||||||| |||||| | |||||| |||| || | ||||||||||||||||||||||||| |
|
|
| T |
25681505 |
gttcttcttgttgttttgatctgctccatgtttggcttttgaaagcaaaggcttgctcttgttgggaagaactttttctctgagctttg |
25681417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 86 - 157
Target Start/End: Complemental strand, 25681737 - 25681666
Alignment:
| Q |
86 |
actatgaaaattaaaatgcattgatcgatcgagtagatatgcaatacaaaccatgcatcttaattaatcttg |
157 |
Q |
| |
|
|||||||||| ||| || ||| |||||||| |||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
25681737 |
actatgaaaagtaacatacatagatcgatcaagtatatatacaatacaaaccatgcatctcaattaatcttg |
25681666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University