View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6730_high_12 (Length: 231)

Name: NF6730_high_12
Description: NF6730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6730_high_12
NF6730_high_12
[»] chr5 (1 HSPs)
chr5 (37-105)||(18160875-18160943)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 37 - 105
Target Start/End: Original strand, 18160875 - 18160943
Alignment:
37 gtgattaggaaataaatgacactacaatctcacatgcaccaaataccatgttccagatccttcgacaac 105  Q
    |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||    
18160875 gtgattaggaaataaatgacaccacaatctcacatgcacctaataccatgttccagatccttcgacaac 18160943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University