View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6730_high_15 (Length: 204)
Name: NF6730_high_15
Description: NF6730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6730_high_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 6 - 204
Target Start/End: Complemental strand, 35023175 - 35022977
Alignment:
| Q |
6 |
cacagtgataaaacaacaaaagaacctccaaaacatgtgtcaaacgtgggacccacaaactggaagttgtcccaacaaaaataggagaaggtgagccagc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35023175 |
cacagtgataaaacaacaaaagaacctccaaaacaagtgtcaaacgtgggacccacaaactggaagttgtcccaacaaaaataggagaaggtgagccagc |
35023076 |
T |
 |
| Q |
106 |
tggaacaaacggtgtcgcaaatgtacgctcagaaggctgcgcgtgattcacgtgccaaatagatgtttggggtgtggaggggcatgaaggggtgttcaa |
204 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
35023075 |
tggaacaaacagtgtcgcaaatgtacgctcagaaggctgcgcgtgattcacgtgccaaatagatgttcggagtgtggaggtgcatgaaggggtgttcaa |
35022977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University