View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6730_low_11 (Length: 342)
Name: NF6730_low_11
Description: NF6730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6730_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 19 - 293
Target Start/End: Original strand, 2389467 - 2389741
Alignment:
| Q |
19 |
aatatgtatgaaatgcaaaggagaaactgaaaggcttgccattgacattccggatgcgagatatcatattcagacggccatctgctgccaaacagaccct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389467 |
aatatgtatgaaatgcaaaggagaaactgaaaggcttgccattgacattccggatgcgagatatcatattcagacggccatctgctgccaaacagaccct |
2389566 |
T |
 |
| Q |
119 |
taggcgaaactcgaagctgaataaaataatttagtacataaaacattgttatccaacaatctcaattctcaagatacatgaaatatacatgttactgtat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389567 |
taggcgaaactcgaagctgaataaaataatttagtacataaaacattgtcatccaacaatctcaattctcaagatacatgaaatatacatgttactgtat |
2389666 |
T |
 |
| Q |
219 |
aggaactggggtatctagctacatgcttctgcaatttctactctcttggatgcgattcatcaattgtcctttaat |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389667 |
aggaactggggtatctagctacatgcttctggaatttctactctcttggatgcgattcatcaattgtcctttaat |
2389741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University