View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6730_low_18 (Length: 232)
Name: NF6730_low_18
Description: NF6730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6730_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 215
Target Start/End: Complemental strand, 36576818 - 36576615
Alignment:
| Q |
12 |
gaaatgaaatctggtggaatacggccgtttgaaaatcgtccggtggggcggccaccatcgatgtcacgaccgtaaggtctaaaattgctctttagaaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36576818 |
gaaatgaaatctggtggaatacggccgtttgaaaatcgtccggtggggcggccaccatcgatgtcacgaccgtaaggtctaaaattgctctttagaaatg |
36576719 |
T |
|
| Q |
112 |
ttgatatcatattgttgtttccagaatcaacagaggagtcaccaaacacaattactgctggtacataattttcattcttgcaagtcaccatgatcatttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36576718 |
ttgatatcatattgttgtttccagaatcaacagaggagtcaccaaacacaattactgctggtacataattttcattattgcaagtcaccatgatcatttg |
36576619 |
T |
|
| Q |
212 |
agtt |
215 |
Q |
| |
|
|||| |
|
|
| T |
36576618 |
agtt |
36576615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 15 - 211
Target Start/End: Complemental strand, 36564186 - 36563990
Alignment:
| Q |
15 |
atgaaatctggtggaatacggccgtttgaaaatcgtccggtggggcggccaccatcgatgtcacgaccgtaaggtctaaaattgctctttagaaatgttg |
114 |
Q |
| |
|
||||| || |||||| |||| ||||| |||| |||||||| ||||||||||| |||| |||||| ||||||||| ||||||||||||| |||| ||| | |
|
|
| T |
36564186 |
atgaagtccggtggagtacgaccgttacaaaaccgtccggtagggcggccaccttcgaagtcacggccgtaaggtttaaaattgctcttgagaagtgtag |
36564087 |
T |
|
| Q |
115 |
atatcatattgttgtttccagaatcaacagaggagtcaccaaacacaattactgctggtacataattttcattcttgcaagtcaccatgatcatttg |
211 |
Q |
| |
|
|||| |||| |||||||||||||| ||||| || |||||||| ||||||||||||||||||| ||||| | ||||||||||||||||||| ||||| |
|
|
| T |
36564086 |
ctatcctattattgtttccagaatccacagaagaatcaccaaagacaattactgctggtacatgatttttagtcttgcaagtcaccatgataatttg |
36563990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University