View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6730_low_20 (Length: 226)
Name: NF6730_low_20
Description: NF6730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6730_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 26786060 - 26786279
Alignment:
| Q |
1 |
cttcaggtatctcgtcaggtgtctcctgaagcctcacaatttgtttatcagaaaacctgaaattagagaagataatttaattgcagtttcaaggtttatg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26786060 |
cttcaggtatctcatcaggtgtctcctgaagcctcacaatttgtttatcagaaaacctgaaattagagaagataatttaattgcagtttcaaggtttatg |
26786159 |
T |
 |
| Q |
101 |
aactgaaatccaagtgaaaaaccttacgccaaatagtcacatgaccaaaacacattgttcaaaacaggggataattaccatggcaagcatccaacatatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26786160 |
aactgaaatccaagtgaaaaaccttacgccaaatagtcacatgaccaaaacacattgtttaaaacaggggataattaccatggcaagcatccaacatatc |
26786259 |
T |
 |
| Q |
201 |
actaaaatatacccagtaca |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26786260 |
actaaaatatacccagtaca |
26786279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University