View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6730_low_21 (Length: 205)
Name: NF6730_low_21
Description: NF6730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6730_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 61 - 184
Target Start/End: Complemental strand, 29766208 - 29766085
Alignment:
| Q |
61 |
cccaaatgaattaaacacacaaagttgacccaatgccatacatatctcaaacccagggggtttgcttgcttatgtaggatttcaattcgggagtgtgctc |
160 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766208 |
cccaagtgagttaaacacacaaagttgacccaatgccatacatatctcaaacccagggggtttgcttgcttatgtaggatttcaattcgggagtgtgctc |
29766109 |
T |
|
| Q |
161 |
atctataggtcttggattcgaatt |
184 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
29766108 |
atctataggtctcggattcgaatt |
29766085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University