View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6731_low_9 (Length: 237)
Name: NF6731_low_9
Description: NF6731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6731_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 47 - 220
Target Start/End: Original strand, 45053683 - 45053850
Alignment:
| Q |
47 |
gcctctgttgtcgttttctctaaatcatcgtctcttgagtata--taaataaaggtgagtgtaaattagcaaagttgatacggattaattctctaatcat |
144 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45053683 |
gcctctgttgtctttttctctaaatcatcgtctcttgagtatatataaataaaggtgagtgtaaattagcaaagttgatacggattaattctctaatcat |
45053782 |
T |
|
| Q |
145 |
cgattgagatattttgttcacatgcaggattggagaatgacgcttaaactcggatatgcatcaaaacagtcttaat |
220 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45053783 |
c--------aattttgttcacatgcaggattggagaatgacgcttaaactcggatatgcatcaaaacagtcttaat |
45053850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University