View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6738_low_17 (Length: 276)
Name: NF6738_low_17
Description: NF6738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6738_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 14 - 217
Target Start/End: Original strand, 26785435 - 26785638
Alignment:
| Q |
14 |
acatcatctagctcccagatgtttggcgccagtgactttgtcagcctttcatagatatctggnnnnnnngagagctccttccgtttagccacctgacact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
26785435 |
acatcatctagctcccagatgtttggcgccagtgactttgtcagcctttcatagatatctggttgttttgagagctccttcagtttagccacctgacact |
26785534 |
T |
|
| Q |
114 |
cagacaagcatgcagttagcgggtgaataaaataagcagataatacattgaagagatgtacaaaatgtaccttttcttcatcaaataaaacttcttctgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26785535 |
cagacaagcatgcagttagcgggtgaataaaacaagcagataattcattgaagagatgtacaaaatgtaccttttcttcatcaaataaaacttcttctgg |
26785634 |
T |
|
| Q |
214 |
attt |
217 |
Q |
| |
|
|||| |
|
|
| T |
26785635 |
attt |
26785638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 214 - 276
Target Start/End: Complemental strand, 26785797 - 26785735
Alignment:
| Q |
214 |
atttagagcttctccttttcatttttcatcttgtctaattgacatttgttttgttttgttcat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26785797 |
atttagagcttctccttttcatttttcatcttgtctaattgacatttgttttcttttgttcat |
26785735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University