View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6741_high_17 (Length: 201)
Name: NF6741_high_17
Description: NF6741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6741_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 5523537 - 5523370
Alignment:
| Q |
19 |
atcatcaaagatataagtgagtacttaaatttacgtgagaccataatatgcctaagaaaaa-taaaaacttaacttgatgtgcaacgtcatgatttcaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5523537 |
atcatcaaagatataagtgagtacttaaatttacgtgagaccataatatgcctaaaaaaaaataaaaacttaacttcatgtgcaacgtcatgatttcaat |
5523438 |
T |
|
| Q |
118 |
ttcaacatcaccatcaatttgtggttctaatccttagcttgattgatgacattgtgagaggaaaacct |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5523437 |
ttcaacatcaccatcaatttgtggttctaatccttagcttgattgatgacattgtgagatgaaaacct |
5523370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University