View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6741_low_15 (Length: 240)
Name: NF6741_low_15
Description: NF6741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6741_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 218
Target Start/End: Complemental strand, 7360847 - 7360639
Alignment:
| Q |
10 |
atgaacaatcaatgtcctcacaagagcaagcactagtctctctcctttcccaactcgccctatctttcgacggcgccgttttaggtttcgccgtcgctta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7360847 |
atgaacaatcaatgtcctcacaagagcaagcactggtctctctcctttcccaactcgccctatctttcgacggcgccgttttaggtttcgccgtcgctta |
7360748 |
T |
|
| Q |
110 |
cgtcgccgttcgctccatccgcaaattcaccctcacctccgccgctcttcgcaaaatcaccgccgctccttccgtctccgtctccgacctccgctcgctc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7360747 |
cgtcgccgttcgctccatccgcaaattcacccttacctccgccgctcttcgcaaaatcaccgccgctccttccgtctccgtctccgacctccgctcgctc |
7360648 |
T |
|
| Q |
210 |
ctcaccgaa |
218 |
Q |
| |
|
||||||||| |
|
|
| T |
7360647 |
ctcaccgaa |
7360639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University