View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6743_high_10 (Length: 268)
Name: NF6743_high_10
Description: NF6743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6743_high_10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 37451544 - 37451295
Alignment:
| Q |
19 |
attacatggttcttttgccaactcgtctcatcattcatcagtatttcacccaagtcacctaagtatttttcgtcagaacctcctgtgagttgttgtggtg |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37451544 |
attacatggctcttttgccaactcgtctcatcattcatcagtatttcacccaagtcacctaagtatttttcgtcagaacctcctgtgagttgttgtggtg |
37451445 |
T |
|
| Q |
119 |
ctcgttcttggctagcttccactattccaacaaacaagtggcgcacttaaaaatttgagcacctgtctcttcaatttgccgccaaagtttcaagttcgta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37451444 |
ctcgttcttggctagcttccactattccaacaaacaagtggcacacttaaaaatttgagcacctgtctcttcaatttgccgccaaagtttcaagttcgta |
37451345 |
T |
|
| Q |
219 |
tttttacaaaggctcctccaaaggatggaaaaagctcgctctatgatact |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37451344 |
tttttacaaaggctcctccaaaggatggaaaaagctcgctctgtgatact |
37451295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University