View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6743_high_11 (Length: 260)
Name: NF6743_high_11
Description: NF6743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6743_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 34 - 244
Target Start/End: Complemental strand, 30019795 - 30019585
Alignment:
| Q |
34 |
aatcatataacggtaacccaacgaacacatttctatttgagaatgagtcgataaaatccctggaaattactaataagcattggcaaatatcatgtgtcct |
133 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30019795 |
aatcatataaatgtaacccaacgaacacatttctatttgagaatgagtcgataaaatccctggaaattactaataagcattggcaaatatcatgtgtcct |
30019696 |
T |
 |
| Q |
134 |
aaagtagagactcttgtatacctttttcattctagagaaatggtaatttggtgataaaagctgaagtattattgaaacaatggaacagctataatattaa |
233 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30019695 |
aaagtagagactcttgtatgcctttttcattctagagaaatggtaatttggtgataaaggctgaagtattattgaaacaatggaacagctataatattaa |
30019596 |
T |
 |
| Q |
234 |
tagggctatat |
244 |
Q |
| |
|
||||||||||| |
|
|
| T |
30019595 |
tagggctatat |
30019585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University