View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6743_high_18 (Length: 221)
Name: NF6743_high_18
Description: NF6743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6743_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 24916201 - 24916403
Alignment:
| Q |
1 |
tcgctttgagaaaggttaaccattattcgcttaacttgttgcagcaaaagtcagcacgcaaaaacaaatgacatatagtttaactttggcttttatagaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24916201 |
tcgctttgagaaaggtcaaccattattcgcttaacttgttgcagcaaaagtcagcacgcaaaaacaaatgacatatagtttaactttggcttttatagaa |
24916300 |
T |
|
| Q |
101 |
agtttgggtggtgaaatagaagtcagaaagatagtccaatttaaccttttaaactaggtattttagggctggcccaacatttgataaggcctaaagtgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24916301 |
agtttgggtggtgaaatagaagtcagaaagatagtccaatttaaccttttaaactaggtattttagggccggcccaacatttgatgaggcctaaagtgaa |
24916400 |
T |
|
| Q |
201 |
ctc |
203 |
Q |
| |
|
||| |
|
|
| T |
24916401 |
ctc |
24916403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University