View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6743_low_12 (Length: 382)
Name: NF6743_low_12
Description: NF6743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6743_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 187 - 359
Target Start/End: Original strand, 18157293 - 18157474
Alignment:
| Q |
187 |
ctttgctgttttgaattgatttgatggcttcagaagctga---------aatttcttctttatttgaaagaatgatccgaaacagagacatgtctctgtt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18157293 |
ctttgctgttttgaattgatttgatggcttcagaagctgaaatttctgaaatttcttctttatttgaaagaatgatccgaaacagagacatgtctctgtt |
18157392 |
T |
|
| Q |
278 |
tttaccctttatgctaagcctttcacaaactttaaacaacagcgacccagatcatgaatccgaaaccaacgaagattccact |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18157393 |
tttaccctttatgctaagcctttcacaaactttaaacaacagcgacccagatcatgaatccgaaaccaatgaagattccact |
18157474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 18157126 - 18157210
Alignment:
| Q |
20 |
atatcgcaacaaatacaccgaaatttcacaacacacgtaatatgttgttccagatccttccacaacgttcttttatctctctata |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
18157126 |
atatcgcaacaaatacaccgaaatttcacaacacacgtaatatgttgttccagatccttccacgacgttcttttttctctctata |
18157210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University