View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6743_low_15 (Length: 282)
Name: NF6743_low_15
Description: NF6743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6743_low_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 9402679 - 9402398
Alignment:
| Q |
1 |
gaggtgatatttcacatccatacatcataccttaaccaaaatatgtttatatcatgaggccacctgagcagaagccctttgatgaggtttttgttgagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
9402679 |
gaggtgatatttcacatccatacatcataccttaaccagaatatgtttatatcatgaggccacctgagcagaagacctttgatgaggttgttgttgagca |
9402580 |
T |
 |
| Q |
101 |
tcatgggaccaataatggctagactttaggatacggttaggccccatcagagaccaagccatactataatggacagtggtcaagtggaggagggaagtcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9402579 |
tcatgggaccaataatggctagactttaggatacggttaggccgcatcagagaccaagccatgctataatggacagtggtcaaatggaggagggaagtcc |
9402480 |
T |
 |
| Q |
201 |
gacttgtattagtttgaatgcaattatgtaaaaggctaagggaggggttgtatatcttcgtaggtgtgttagcgtgcatggt |
282 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
9402479 |
gacttgtattagtctgaatgcaattatgtaaaaggcttagggaggggttgcatatcgccgtaggtgtgttagggtgcatggt |
9402398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 258
Target Start/End: Original strand, 40975892 - 40975963
Alignment:
| Q |
187 |
gaggagggaagtccgacttgtattagtttgaatgcaattatgtaaaaggctaagggaggggttgtatatctt |
258 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||||||||| | ||||| |||||||| |||| |||||| |
|
|
| T |
40975892 |
gaggagggaagtccgacttggatttgtttgcatgcaattatacatgaggcttagggagggattgtttatctt |
40975963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University