View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6743_low_29 (Length: 206)

Name: NF6743_low_29
Description: NF6743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6743_low_29
NF6743_low_29
[»] chr4 (1 HSPs)
chr4 (73-206)||(55719386-55719519)


Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 73 - 206
Target Start/End: Complemental strand, 55719519 - 55719386
Alignment:
73 ataattcatatgttatctagggcggctaagttgtatatttctcatcatctcttaatttaattctattctatatttcaactcttgttttaaatatgataca 172  Q
    |||| |||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55719519 ataagtcatgtgttatttagggcggctaagttgtatatttctcatcatctcttaatttaattctattctatatttcaactcttgttttaaatatgataca 55719420  T
173 tcaatatcatatatgtctatctctctttcttttt 206  Q
    ||||||||||||||||||||||||||| ||||||    
55719419 tcaatatcatatatgtctatctctcttacttttt 55719386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University