View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6743_low_29 (Length: 206)
Name: NF6743_low_29
Description: NF6743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6743_low_29 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 73 - 206
Target Start/End: Complemental strand, 55719519 - 55719386
Alignment:
| Q |
73 |
ataattcatatgttatctagggcggctaagttgtatatttctcatcatctcttaatttaattctattctatatttcaactcttgttttaaatatgataca |
172 |
Q |
| |
|
|||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55719519 |
ataagtcatgtgttatttagggcggctaagttgtatatttctcatcatctcttaatttaattctattctatatttcaactcttgttttaaatatgataca |
55719420 |
T |
|
| Q |
173 |
tcaatatcatatatgtctatctctctttcttttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
55719419 |
tcaatatcatatatgtctatctctcttacttttt |
55719386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University