View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6745_high_25 (Length: 309)
Name: NF6745_high_25
Description: NF6745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6745_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 206
Target Start/End: Original strand, 37879549 - 37879744
Alignment:
| Q |
11 |
gaagaagaaggatattgattatgagggtaaggaacagcaccagctttcaccaagaaatcttcaagagtaacttcatcaccaccaccggcaccgcaagcag |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879549 |
gaagaagaaggatattgatgatgagggtaaggaacagcaccagctttcaccaagaaatcttcaagagtaacttcatcaccaccaccggcaccgcaagcag |
37879648 |
T |
 |
| Q |
111 |
aaaaaccttcatcagaagaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacatcgtcaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879649 |
aaaaaccttcatcagaagaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacatcgtcaa |
37879744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University