View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6745_high_39 (Length: 235)
Name: NF6745_high_39
Description: NF6745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6745_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 30463560 - 30463774
Alignment:
| Q |
1 |
cacacgttctctctatccttcacaaaactatcttacaatataaaccctataccatttctaagcttttctcannnnnnnn-ctcaattttcatgtacataa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30463560 |
cacacgttctctctatccttcacaaaactatcttacaatataaaccctataccatttctaagcttttctcatttttttttctcaattttcatgtacataa |
30463659 |
T |
|
| Q |
100 |
taagcattgcttaacgtgcaaccaaaaataataattcacctagctttacatattgagtttcccattttgttattattagaaagttgagtgcttgagtgtg |
199 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30463660 |
---gcattgcttaatgtgcaaccaaagataataattcacctagctttacatattgagtttcccattttgttattattagaaagttgagtacttgagtgtg |
30463756 |
T |
|
| Q |
200 |
gatctagaattattattg |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30463757 |
gatctagaattattattg |
30463774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University