View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6745_high_42 (Length: 209)
Name: NF6745_high_42
Description: NF6745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6745_high_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 62 - 187
Target Start/End: Original strand, 35272444 - 35272568
Alignment:
| Q |
62 |
gcaaggggcatcaatgaagaaaccattcttgggaaacatgattaaagnnnnnnnnnnnnnnnncagacatgaataattttagaactgacattactaccga |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35272444 |
gcaaggggcatcaatgaagaaaccattcttgggaaacatgattaaagaaaaaactaaaaaaa-cagacatgaatgattttagaactgacattactaccga |
35272542 |
T |
|
| Q |
162 |
aattgcacatcaagaactgattaatg |
187 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35272543 |
aattgcacatcaagaactgattaatg |
35272568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University