View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6745_low_10 (Length: 521)
Name: NF6745_low_10
Description: NF6745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6745_low_10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 477; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 477; E-Value: 0
Query Start/End: Original strand, 1 - 521
Target Start/End: Original strand, 29052782 - 29053302
Alignment:
| Q |
1 |
tgctgcaacagaaaacggagagaataatgatgaagtatcaggaatggctaaagcatttcacatatcatcaagaacagcttctgctataacaatatgtata |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052782 |
tgctgcaacagaaaacggggagaataatgatgaagtatcaggaatggctaaagcatttcacatatcatcaagaacagcttctgctataacaatatgtata |
29052881 |
T |
|
| Q |
101 |
gtaatggctgcacttgtttttcctttgtttatgacatctttaggacaaggtttggcattgaagacaaagatgttatcatatggaacacttttgtttggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052882 |
gtaatggctgcacttgtttttcctttgtttatgacatctttaggacaaggtttggcattgaagacaaagatgttatcatatggaacacttttgtttggat |
29052981 |
T |
|
| Q |
201 |
tttacatggcttggaacattggtgctaatgatgttgcaaatgcaatgggaacttctgttggatctggtgcattgtcacttaggcaagctgtgttaacagc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29052982 |
tttacatggcttggaacattggtgctaatgatgttgcaaatgcaatgggaacttcagttggatctggtgcattgtcacttaggcaagctgtgttgacagc |
29053081 |
T |
|
| Q |
301 |
tgcagtgttggagttttctggggcattgttgatgggaactcatgtgacaagtacaatgcagaagggaattcttgttgctaatgtttttcaggggaaggat |
400 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29053082 |
tgcagtgttggagttttcaggggcattgttgatgggaactcatgtgactagtacaatgcagaagggaattcttgttgctaatgtttttcaggggaaggat |
29053181 |
T |
|
| Q |
401 |
actttgctttttgcagggttgctttcttctcttgctgctgctggtacttggttacaggtnnnnnnnntacattgtttcgcaatttagtactaactccgtc |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29053182 |
actttgctttttgcagggttgctttcttctcttgctgctgctggtacttggttacaggtaaaaaaaatacattgtttcgcaatttagtactaactccgtc |
29053281 |
T |
|
| Q |
501 |
cctgaatataagatcttattg |
521 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29053282 |
cctgaatataagatcttattg |
29053302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University