View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6745_low_24 (Length: 380)
Name: NF6745_low_24
Description: NF6745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6745_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 178 - 363
Target Start/End: Complemental strand, 10200098 - 10199913
Alignment:
| Q |
178 |
acagtctcctaaaatcttaattcaatacaatccataacttcatgatattagtggcatacattcacttttcaattaacaatatatgaattctcctcacttc |
277 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
10200098 |
acagtctcctaaaatcttaattcaatgcaccccataacttcatgatattagtggcatacattcacttttcaattaacaatatatgaactctcttcacttc |
10199999 |
T |
|
| Q |
278 |
tcgtccaaacccaatagtttcagcttggtcccaacttcgtcccacataannnnnnngacaagaaatgttcaaataatagtgtaaca |
363 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10199998 |
tcgtccaaacccaatagtttcaggttggtcccaacttcgtcccacataatttttttgacaagaaatgttcaaataatagtgtaaca |
10199913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 10200270 - 10200224
Alignment:
| Q |
18 |
cttataacttcataaaatactttgaaattttaagtttgtattatata |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10200270 |
cttataacttcataaaatactttgaaattttaagtttgtattatata |
10200224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University